pcms egfp rtp801 (Addgene inc)
Addgene inc is a verified supplier 
88
Structured Review
Addgene inc
pcms egfp rtp801
Pcms Egfp Rtp801, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcms+egfp+rtp801/pCMS-eGFP-RTP801+(Plasmid+%2365057)/bio_rxiv__2025__06__09__658667-254-20-22
Average 88 stars, based on 8 article reviews
Pcms Egfp Rtp801, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcms+egfp+rtp801/pCMS-eGFP-RTP801+(Plasmid+%2365057)/bio_rxiv__2025__06__09__658667-254-20-22
Average 88 stars, based on 8 article reviews
pcms egfp rtp801 - by Bioz Stars,
2026-10
88/100 stars
Images
Related Articles
Retroviral:Article Title: Inhibition of the STAT5/Pim Kinase Axis Enhances Cytotoxic Effects of Proteasome Inhibitors on FLT3-ITD–Positive AML Cells by Cooperatively Inhibiting the mTORC1/4EBP1/S6K/Mcl-1 Pathway Article Snippet: .. For construction of a retroviral expression plasmid for inducible expression of REDD1, pRevTRE-REDD1, the EcoRI/SalI fragment of Expressing:Article Title: Inhibition of the STAT5/Pim Kinase Axis Enhances Cytotoxic Effects of Proteasome Inhibitors on FLT3-ITD–Positive AML Cells by Cooperatively Inhibiting the mTORC1/4EBP1/S6K/Mcl-1 Pathway Article Snippet: .. For construction of a retroviral expression plasmid for inducible expression of REDD1, pRevTRE-REDD1, the EcoRI/SalI fragment of Article Title: ATF4 activates a transcriptional program that chronically suppresses mTOR activity promoting neurodegeneration in Parkinson’s disease models Article Snippet: .. Shuttle plasmids for the generation of recombinant adenoviral vectors expressing Trib3, DDIT4 and SESN2 were constructed from pcDNA-Trb3 (Addgene #131157), Plasmid Preparation:Article Title: Inhibition of the STAT5/Pim Kinase Axis Enhances Cytotoxic Effects of Proteasome Inhibitors on FLT3-ITD–Positive AML Cells by Cooperatively Inhibiting the mTORC1/4EBP1/S6K/Mcl-1 Pathway Article Snippet: .. For construction of a retroviral expression plasmid for inducible expression of REDD1, pRevTRE-REDD1, the EcoRI/SalI fragment of Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress Article Snippet: RTP801 siRNA were prepared by GenePharma based on the following sequences: 5‐AAGACTCCTCATACCTGGATG‐3, which targeting both mouse and rat RTP801 sequence. .. RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from Construct:Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress Article Snippet: RTP801 siRNA were prepared by GenePharma based on the following sequences: 5‐AAGACTCCTCATACCTGGATG‐3, which targeting both mouse and rat RTP801 sequence. .. RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from Article Title: Loss of NEDD4 contributes to RTP801 elevation and neuron toxicity: implications for Parkinson's disease Article Snippet: Horseradish peroxidase-conjugated goat anti-mouse and anti-rabbit secondary antibodies were obtained from Pierce Thermo Fisher Scientific (Rockford, IL, USA). .. Goat anti-mouse and anti-rabbit secondary antibodies conjugated to Alexa 488 or Alexa 568 were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Article Title: ATF4 activates a transcriptional program that chronically suppresses mTOR activity promoting neurodegeneration in Parkinson’s disease models Article Snippet: .. Shuttle plasmids for the generation of recombinant adenoviral vectors expressing Trib3, DDIT4 and SESN2 were constructed from pcDNA-Trb3 (Addgene #131157), Generated:Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress Article Snippet: RTP801 siRNA were prepared by GenePharma based on the following sequences: 5‐AAGACTCCTCATACCTGGATG‐3, which targeting both mouse and rat RTP801 sequence. .. RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from Article Title: Loss of NEDD4 contributes to RTP801 elevation and neuron toxicity: implications for Parkinson's disease Article Snippet: Horseradish peroxidase-conjugated goat anti-mouse and anti-rabbit secondary antibodies were obtained from Pierce Thermo Fisher Scientific (Rockford, IL, USA). .. Goat anti-mouse and anti-rabbit secondary antibodies conjugated to Alexa 488 or Alexa 568 were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Polymerase Chain Reaction:Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress Article Snippet: RTP801 siRNA were prepared by GenePharma based on the following sequences: 5‐AAGACTCCTCATACCTGGATG‐3, which targeting both mouse and rat RTP801 sequence. .. RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from Clone Assay:Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress Article Snippet: RTP801 siRNA were prepared by GenePharma based on the following sequences: 5‐AAGACTCCTCATACCTGGATG‐3, which targeting both mouse and rat RTP801 sequence. .. RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from Recombinant:Article Title: ATF4 activates a transcriptional program that chronically suppresses mTOR activity promoting neurodegeneration in Parkinson’s disease models Article Snippet: .. Shuttle plasmids for the generation of recombinant adenoviral vectors expressing Trib3, DDIT4 and SESN2 were constructed from pcDNA-Trb3 (Addgene #131157), Cloning:Article Title: ATF4 activates a transcriptional program that chronically suppresses mTOR activity promoting neurodegeneration in Parkinson’s disease models Article Snippet: .. Shuttle plasmids for the generation of recombinant adenoviral vectors expressing Trib3, DDIT4 and SESN2 were constructed from pcDNA-Trb3 (Addgene #131157), |